Human PMP22/CMT1A/CMT1E ORF/cDNA clone-Adenovirus particle (BC019040)
Cat. No.: vGMAP000148
Pre-made Human PMP22/CMT1A/CMT1E Adenovirus for PMP22 overexpression in-vitro and in-vivo. The PMP22 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PMP22-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
PMP22/CMT1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000148 | Human PMP22 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000148 |
Gene Name | PMP22 |
Accession Number | BC019040 |
Gene ID | 5376 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 483 bp |
Gene Alias | CMT1A,CMT1E,DSS,GAS-3,HMSNIA,HNPP,MGC20769,Sp110 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGCTCCTCCTGTTGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGATCGTCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCTCTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTGTCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCTGCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGAATCTTCCAAATTCTTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGGCACCCGGAGTGGCATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGGGTGGCCTTCCCCCTGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGA |
ORF Protein Sequence | MLLLLLSIIVLHVAVLVLLFVSTIVSQWIVGNGHATDLWQNCSTSSSGNVHHCFSSSPNEWLQSVQATMILSIIFSILSLFLFFCQLFTLTKGGRFYITGIFQILAGLCVMSAAAIYTVRHPEWHLNSDYSYGFAYILAWVAFPLALLSGVIYVILRKRE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1395-Ab | Anti-PMP22/ CIDP/ CMT1A monoclonal antibody |
Target Antigen | GM-Tg-g-MP1395-Ag | PMP22 VLP (virus-like particle) |
ORF Viral Vector | pGMLP000512 | Human PMP22 Lentivirus plasmid |
ORF Viral Vector | pGMAP000148 | Human PMP22 Adenovirus plasmid |
ORF Viral Vector | vGMLP000512 | Human PMP22 Lentivirus particle |
ORF Viral Vector | vGMAP000148 | Human PMP22 Adenovirus particle |
Target information
Target ID | GM-MP1395 |
Target Name | PMP22 |
Gene ID | 5376, 18858, 693527, 24660, 101092215, 479509, 534497, 100034146 |
Gene Symbol and Synonyms | CIDP,CMT1A,CMT1E,DSS,GAS-3,GAS3,HMSNIA,HNPP,PMP-22,PMP22,Sp110,Tr,TRE002,trembler |
Uniprot Accession | Q01453 |
Uniprot Entry Name | PMP22_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000109099 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.