Human PMP22/CIDP/CMT1A ORF/cDNA clone-Lentivirus particle (NM_000304)

Cat. No.: vGMLP000512

Pre-made Human PMP22/CIDP/CMT1A Lentiviral expression plasmid for PMP22 lentivirus packaging, PMP22 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PMP22/CIDP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000512 Human PMP22 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000512
Gene Name PMP22
Accession Number NM_000304
Gene ID 5376
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 483 bp
Gene Alias CIDP,CMT1A,CMT1E,DSS,GAS-3,GAS3,HMSNIA,HNPP,Sp110
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCCTCCTGTTGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGATCGTCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCTCTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTGTCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCTGCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGAATCTTCCAAATTCTTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGGCACCCGGAGTGGCATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGGGTGGCCTTCCCCCTGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGA
ORF Protein Sequence MLLLLLSIIVLHVAVLVLLFVSTIVSQWIVGNGHATDLWQNCSTSSSGNVHHCFSSSPNEWLQSVQATMILSIIFSILSLFLFFCQLFTLTKGGRFYITGIFQILAGLCVMSAAAIYTVRHPEWHLNSDYSYGFAYILAWVAFPLALLSGVIYVILRKRE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1395-Ab Anti-PMP22/ CIDP/ CMT1A monoclonal antibody
    Target Antigen GM-Tg-g-MP1395-Ag PMP22 VLP (virus-like particle)
    ORF Viral Vector pGMLP000512 Human PMP22 Lentivirus plasmid
    ORF Viral Vector pGMAP000148 Human PMP22 Adenovirus plasmid
    ORF Viral Vector vGMLP000512 Human PMP22 Lentivirus particle
    ORF Viral Vector vGMAP000148 Human PMP22 Adenovirus particle


    Target information

    Target ID GM-MP1395
    Target Name PMP22
    Gene ID 5376, 18858, 693527, 24660, 101092215, 479509, 534497, 100034146
    Gene Symbol and Synonyms CIDP,CMT1A,CMT1E,DSS,GAS-3,GAS3,HMSNIA,HNPP,PMP-22,PMP22,Sp110,Tr,TRE002,trembler
    Uniprot Accession Q01453
    Uniprot Entry Name PMP22_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000109099
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.