Human FKBP1A/FKBP-12/ FKBP12 ORF/cDNA clone-Adenovirus plasmid (BC119732)
Pre-made Human FKBP1A/FKBP-12/ FKBP12 adenoviral expression plasmid for FKBP1A adenovirus packaging, FKBP1A adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to FKBP1A/FKBP-12 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000487 | Human FKBP1A Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000487 |
Gene Name | FKBP1A |
Accession Number | BC119732 |
Gene ID | 2280 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 438 bp |
Gene Alias | FKBP-12, FKBP12, FKBP12C, PKC12, PKCI2, PPIASE |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCAGGCAACGCGCTGAGGGACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCCATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0019-Ab | Anti-FKBP1A monoclonal antibody |
Target Antigen | GM-Tg-g-IP0019-Ag | FKBP1A protein |
ORF Viral Vector | pGMLP000449 | Human FKBP1A Lentivirus plasmid |
ORF Viral Vector | pGMAP000355 | Human FKBP1A Adenovirus plasmid |
ORF Viral Vector | pGMAP000487 | Human FKBP1A Adenovirus plasmid |
ORF Viral Vector | vGMLP000449 | Human FKBP1A Lentivirus particle |
ORF Viral Vector | vGMAP000355 | Human FKBP1A Adenovirus particle |
ORF Viral Vector | vGMAP000487 | Human FKBP1A Adenovirus particle |
Target information
Target ID | GM-IP0019 |
Target Name | FKBP1A |
Gene ID | 2280, 14225, 717385, 25639, 101100379, 100686033, 614795, 100629541 |
Gene Symbol and Synonyms | Fkbp,FKBP-12,FKBP-1A,FKBP1,FKBP12,FKBP1A,FKBP1B,Fkbp2,PKC12,PKCI2,PPIASE |
Uniprot Accession | P62942 |
Uniprot Entry Name | FKB1A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000088832 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.