Human FKBP1A/FKBP-12/ FKBP12 ORF/cDNA clone-Adenovirus particle (BC119732)

Pre-made Human FKBP1A/FKBP-12/ FKBP12 Adenovirus for FKBP1A overexpression in-vitro and in-vivo. The FKBP1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FKBP1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to FKBP1A/FKBP-12 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000487 Human FKBP1A Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000487
Gene Name FKBP1A
Accession Number BC119732
Gene ID 2280
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 438 bp
Gene Alias FKBP-12, FKBP12, FKBP12C, PKC12, PKCI2, PPIASE
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCAGGCAACGCGCTGAGGGACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCCATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0019-Ab Anti-FKBP1A monoclonal antibody
    Target Antigen GM-Tg-g-IP0019-Ag FKBP1A protein
    ORF Viral Vector pGMLP000449 Human FKBP1A Lentivirus plasmid
    ORF Viral Vector pGMAP000355 Human FKBP1A Adenovirus plasmid
    ORF Viral Vector pGMAP000487 Human FKBP1A Adenovirus plasmid
    ORF Viral Vector vGMLP000449 Human FKBP1A Lentivirus particle
    ORF Viral Vector vGMAP000355 Human FKBP1A Adenovirus particle
    ORF Viral Vector vGMAP000487 Human FKBP1A Adenovirus particle


    Target information

    Target ID GM-IP0019
    Target Name FKBP1A
    Gene ID 2280, 14225, 717385, 25639, 101100379, 100686033, 614795, 100629541
    Gene Symbol and Synonyms Fkbp,FKBP-12,FKBP-1A,FKBP1,FKBP12,FKBP1A,FKBP1B,Fkbp2,PKC12,PKCI2,PPIASE
    Uniprot Accession P62942
    Uniprot Entry Name FKB1A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000088832
    Target Classification Not Available

    The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.