Human IL15RA/CD215 ORF/cDNA clone-Lentivirus plasmid (NM_002189)

Cat. No.: pGMLV001104
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL15RA/CD215 Lentiviral expression plasmid for IL15RA lentivirus packaging, IL15RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IL15RA/CD215 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $501
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001104
Gene Name IL15RA
Accession Number NM_002189
Gene ID 3601
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 804 bp
Gene Alias CD215
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCCGCGGCGGGCGCGCGGCTGCCGGACCCTCGGTCTCCCGGCGCTGCTACTGCTGCTGCTGCTCCGGCCGCCGGCGACGCGGGGCATCACGTGCCCTCCCCCCATGTCCGTGGAACACGCAGACATCTGGGTCAAGAGCTACAGCTTGTACTCCAGGGAGCGGTACATTTGTAACTCTGGTTTCAAGCGTAAAGCCGGCACGTCCAGCCTGACGGAGTGCGTGTTGAACAAGGCCACGAATGTCGCCCACTGGACAACCCCCAGTCTCAAATGCATTAGAGACCCTGCCCTGGTTCACCAAAGGCCAGCGCCACCCTCCACAGTAACGACGGCAGGGGTGACCCCACAGCCAGAGAGCCTCTCCCCTTCTGGAAAAGAGCCCGCAGCTTCATCTCCCAGCTCAAACAACACAGCGGCCACAACAGCAGCTATTGTCCCGGGCTCCCAGCTGATGCCTTCAAAATCACCTTCCACAGGAACCACAGAGATAAGCAGTCATGAGTCCTCCCACGGCACCCCCTCTCAGACAACAGCCAAGAACTGGGAACTCACAGCATCCGCCTCCCACCAGCCGCCAGGTGTGTATCCACAGGGCCACAGCGACACCACTGTGGCTATCTCCACGTCCACTGTCCTGCTGTGTGGGCTGAGCGCTGTGTCTCTCCTGGCATGCTACCTCAAGTCAAGGCAAACTCCCCCGCTGGCCAGCGTTGAAATGGAAGCCATGGAGGCTCTGCCGGTGACTTGGGGGACCAGCAGCAGAGATGAAGACTTGGAAAACTGCTCTCACCACCTATGA
ORF Protein Sequence MAPRRARGCRTLGLPALLLLLLLRPPATRGITCPPPMSVEHADIWVKSYSLYSRERYICNSGFKRKAGTSSLTECVLNKATNVAHWTTPSLKCIRDPALVHQRPAPPSTVTTAGVTPQPESLSPSGKEPAASSPSSNNTAATTAAIVPGSQLMPSKSPSTGTTEISSHESSHGTPSQTTAKNWELTASASHQPPGVYPQGHSDTTVAISTSTVLLCGLSAVSLLACYLKSRQTPPLASVEMEAMEALPVTWGTSSRDEDLENCSHHL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-928 Pre-Made Nogapendekin Alfa Biosimilar, Recombinant Protein targeting IL15RA: Recombinant therapeutic protein targeting CD215
    Target Antibody GM-Tg-g-T48429-Ab Anti-I15RA/ IL15RA/ CD215 monoclonal antibody
    Target Antigen GM-Tg-g-T48429-Ag IL15RA VLP (virus-like particle)
    ORF Viral Vector pGMLP001006 Human IL15RA Lentivirus plasmid
    ORF Viral Vector pGMLV001104 Human IL15RA Lentivirus plasmid
    ORF Viral Vector vGMLP001006 Human IL15RA Lentivirus particle
    ORF Viral Vector vGMLV001104 Human IL15RA Lentivirus particle


    Target information

    Target ID GM-T48429
    Target Name IL15RA
    Gene ID 3601, 16169, 712788, 690369, 101082243, 487141, 615030, 100070311
    Gene Symbol and Synonyms CD215,IL-15RA,IL15RA
    Uniprot Accession Q13261
    Uniprot Entry Name I15RA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Lung Cancer
    Gene Ensembl ENSG00000134470
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.