Human TMIGD1/TMIGD/UNQ9372 ORF/cDNA clone-Lentivirus plasmid (NM_206832.2)

Cat. No.: pGMLV001376
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMIGD1/TMIGD/UNQ9372 Lentiviral expression plasmid for TMIGD1 lentivirus packaging, TMIGD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TMIGD1/TMIGD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $497.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001376
Gene Name TMIGD1
Accession Number NM_206832.2
Gene ID 388364
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 789 bp
Gene Alias TMIGD,UNQ9372
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATGGAAGAGCAGTGTCATAATGCAAATGGGAAGATTTCTTCTCTTAGTAATTTTATTTCTGCCACGTGAGATGACAAGTTCTGTTTTAACTGTGAATGGTAAAACTGAGAACTATATCCTGGATACTACACCTGGCTCCCAAGCATCTCTGATATGTGCTGTTCAAAACCACACCAGAGAGGAAGAACTGCTCTGGTACCGAGAGGAGGGGAGAGTGGATTTGAAATCTGGAAACAAAATCAATTCCAGCTCTGTCTGTGTCTCTTCCATCAGTGAAAATGACAACGGAATCAGCTTTACCTGCAGGCTGGGGAGGGATCAGTCCGTGTCCGTTTCGGTGGTGCTGAATGTTACTTTTCCTCCTCTCCTAAGTGGAAACGACTTCCAAACAGTTGAGGAAGGCAGTAATGTGAAGTTGGTTTGCAATGTGAAAGCCAACCCCCAGGCTCAAATGATGTGGTACAAAAACAGTAGTCTCCTCGATTTAGAGAAAAGCCGTCACCAAATCCAACAGACAAGTGAGTCTTTTCAGCTGTCAATCACCAAAGTCGAGAAGCCTGACAACGGAACCTACAGTTGTATTGCAAAGTCATCTCTGAAAACGGAGAGCTTGGACTTTCACCTGATTGTTAAAGATAAAACTGTGGGTGTACCAATAGAGCCCATTATTGCTGCATGTGTTGTGATCTTTCTGACATTGTGCTTTGGACTGATTGCTAGAAGAAAGAAAATAATGAAGCTCTGCATGAAGGATAAAGACCCTCACAGTGAAACAGCTCTATGA
ORF Protein Sequence MAWKSSVIMQMGRFLLLVILFLPREMTSSVLTVNGKTENYILDTTPGSQASLICAVQNHTREEELLWYREEGRVDLKSGNKINSSSVCVSSISENDNGISFTCRLGRDQSVSVSVVLNVTFPPLLSGNDFQTVEEGSNVKLVCNVKANPQAQMMWYKNSSLLDLEKSRHQIQQTSESFQLSITKVEKPDNGTYSCIAKSSLKTESLDFHLIVKDKTVGVPIEPIIAACVVIFLTLCFGLIARRKKIMKLCMKDKDPHSETAL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1846-Ab Anti-TMIG1/ TMIGD1/ TMIGD monoclonal antibody
    Target Antigen GM-Tg-g-MP1846-Ag TMIGD1 VLP (virus-like particle)
    ORF Viral Vector pGMLV001376 Human TMIGD1 Lentivirus plasmid
    ORF Viral Vector vGMLV001376 Human TMIGD1 Lentivirus particle


    Target information

    Target ID GM-MP1846
    Target Name TMIGD1
    Gene ID 388364, 66601, 712350, 363654, 101090660, 611097, 506345, 100072228
    Gene Symbol and Synonyms 2010002A20Rik,RGD1307444,TMIGD,TMIGD1,UNQ9372
    Uniprot Accession Q6UXZ0
    Uniprot Entry Name TMIG1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000182271
    Target Classification Not Available

    Involved in several processes, including negative regulation of apoptotic process; regulation of cell migration; and regulation of membrane permeability. Located in cytoplasm and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.