Human ERBB3/c-erbB-3/ c-erbB3 ORF/cDNA clone-Adenovirus particle (BC002706)
Pre-made Human ERBB3/c-erbB-3/ c-erbB3 Adenovirus for ERBB3 overexpression in-vitro and in-vivo. The ERBB3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified ERBB3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to Erbb-3/ERBB3/c-erbB-3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000169 | Human ERBB3 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000169 |
Gene Name | ERBB3 |
Accession Number | BC002706 |
Gene ID | 2065 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 996 bp |
Gene Alias | c-erbB-3, c-erbB3, ErbB-3, erbB3-S, HER3, MDA-BF-1, p180-ErbB3, p45-sErbB3, p85-sErbB3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGGCGAACGACGCTCTGCAGGTGCTGGGCTTGCTTTTCAGCCTGGCCCGGGGCTCCGAGGTGGGCAACTCTCAGGCAGTGTGTCCTGGGACTCTGAATGGCCTGAGTGTGACCGGCGATGCTGAGAACCAATACCAGACACTGTACAAGCTCTACGAGAGGTGTGAGGTGGTGATGGGGAACCTTGAGATTGTGCTCACGGGACACAATGCCGACCTCTCCTTCCTGCAGTGGATTCGAGAAGTGACAGGCTATGTCCTCGTGGCCATGAATGAATTCTCTACTCTACCATTGCCCAACCTCCGCGTGGTGCGAGGGACCCAGGTCTACGATGGGAAGTTTGCCATCTTCGTCATGTTGAACTATAACACCAACTCCAGCCACGCTCTGCGCCAGCTCCGCTTGACTCAGCTCACCGAGATTCTGTCAGGGGGTGTTTATATTGAGAAGAACGATAAGCTTTGTCACATGGACACAATTGACTGGAGGGACATCGTGAGGGACCGAGATGCTGAGATAGTGGTGAAGGACAATGGCAGAAGCTGTCCCCCCTGTCATGAGGTTTGCAAGGGGCGATGCTGGGGTCCTGGATCAGAAGACTGCCAGACATTGACCAAGACCATCTGTGCTCCTCAGTGTAATGGTCACTGCTTTGGGCCCAACCCCAACCAGTGCTGCCATGATGAGTGTGCCGGGGGCTGCTCAGGCCCTCAGGACACAGACTGCTTTGCCTGCCGGCACTTCAATGACAGTGGAGCCTGTGTACCTCGCTGTCCACAGCCTCTTGTCTACAACAAGCTAACTTTCCAGCTGGAACCCAATCCCCACACCAAGTATCAGTATGGAGGAGTTTGTGTAGCCAGCTGTCCCCATAACTTTGTGGTGGATCAAACATCCTGTGTCAGGGCCTGTCCTCCTGACAAGATGGAAGTAGATAAAAATGGGCTCAAGATGTGTGAGCCTTGTGGGGGACTATGTCCCAAAGCCTTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T86350 |
Target Name | Erbb-3 |
Gene ID | 2065, 13867, 711407, 29496, 101085388, 481105, 785655, 100059216 |
Gene Symbol and Synonyms | c-erbB-3,c-erbB3,ErbB-3,ERBB3,erbB3-S,Erbb3r,FERLK,HER3,LCCS2,MDA-BF-1,nuc-ErbB3,p180-ErbB3,p45-sErbB3,p85-sErbB3,VSCN1 |
Uniprot Accession | P21860 |
Uniprot Entry Name | ERBB3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Non-Small Cell Lung Cancer, Prostate Cancer |
Gene Ensembl | ENSG00000065361 |
Target Classification | Checkpoint-Immuno Oncology, Kinase |
This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.