Human TNF/DIF/ TNF-alpha ORF/cDNA clone-Adenovirus particle (BC028148)
Pre-made Human TNF/DIF/ TNF-alpha Adenovirus for TNF overexpression in-vitro and in-vivo. The TNF adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TNF-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to TNF/DIF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000307 | Human TNF Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000307 |
Gene Name | TNF |
Accession Number | BC028148 |
Gene ID | 7124 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 702 bp |
Gene Alias | DIF, TNF-alpha, TNFSF2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATCGTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGGGAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCTTCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCGTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T20178 |
Target Name | TNF |
Gene ID | 7124, 21926, 715467, 24835, 493755, 403922, 280943, 100033834 |
Gene Symbol and Synonyms | cTNF,DIF,RATTNF,TNF,TNF-a,TNF-alpha,TNFA,TNFalpha,Tnfsf1a,TNFSF2,TNLG1F |
Uniprot Accession | P01375 |
Uniprot Entry Name | TNFA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Ovary Cancer, toluene diisocyanate asthma, Giant Cell Arteritis, Polymyalgia Rheumatica, Chronic Kidney Disease, Dent disease, Hodgkin's disease, Kidney transplant rejection, pancreatic cancer, Chronic Glomerulonephritis, Asthma |
Gene Ensembl | ENSG00000232810 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, psoriasis, rheumatoid arthritis ankylosing spondylitis, tuberculosis, autosomal dominant polycystic kidney disease, and cancer. Mutations in this gene affect susceptibility to cerebral malaria, septic shock, and Alzheimer disease. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.