Human CCKBR/CCK-B/CCK2R ORF/cDNA clone-Lentivirus plasmid (NM_176875.4)
Cat. No.: pGMLV002240
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CCKBR/CCK-B/CCK2R Lentiviral expression plasmid for CCKBR lentivirus packaging, CCKBR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CCKBR/CCK-B products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV002240 |
| Gene Name | CCKBR |
| Accession Number | NM_176875.4 |
| Gene ID | 887 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1344 bp |
| Gene Alias | CCK-B,CCK2R,GASR |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAGCTGCTAAAGCTGAACCGGAGCGTGCAGGGAACCGGACCCGGGCCGGGGGCTTCCCTGTGCCGCCCGGGGGCGCCTCTCCTCAACAGCAGCAGTGTGGGCAACCTCAGCTGCGAGCCCCCTCGCATTCGCGGAGCCGGGACACGAGAATTGGAGCTGGCCATTAGAATCACTCTTTACGCAGTGATCTTCCTGATGAGCGTTGGAGGAAATATGCTCATCATCGTGGTCCTGGGACTGAGCCGCCGCCTGAGGACTGTCACCAATGCCTTCCTCCTCTCACTGGCAGTCAGCGACCTCCTGCTGGCTGTGGCTTGCATGCCCTTCACCCTCCTGCCCAATCTCATGGGCACATTCATCTTTGGCACCGTCATCTGCAAGGCGGTTTCCTACCTCATGGGGGTGTCTGTGAGTGTGTCCACGCTAAGCCTCGTGGCCATCGCACTGGAGCGGTACAGCGCCATCTGCCGACCACTGCAGGCACGAGTGTGGCAGACGCGCTCCCACGCGGCTCGCGTGATTGTAGCCACGTGGCTGCTGTCCGGACTACTCATGGTGCCCTACCCCGTGTACACTGTCGTGCAACCAGTGGGGCCTCGTGTGCTGCAGTGCGTGCATCGCTGGCCCAGTGCGCGGGTCCGCCAGACCTGGTCCGTACTGCTGCTTCTGCTCTTGTTCTTCATCCCGGGTGTGGTTATGGCCGTGGCCTACGGGCTTATCTCTCGCGAGCTCTACTTAGGGCTTCGCTTTGACGGCGACAGTGACAGCGACAGCCAAAGCAGGGTCCGAAACCAAGGCGGGCTGCCAGGGGCTGTTCACCAGAACGGGCGTTGCCGGCCTGAGACTGGCGCGGTTGGCGAAGACAGCGATGGCTGCTACGTGCAACTTCCACGTTCCCGGCCTGCCCTGGAGCTGACGGCGCTGACGGCTCCTGGGCCGGGATCCGGCTCCCGGCCCACCCAGGCCAAGCTGCTGGCTAAGAAGCGCGTGGTGCGAATGTTGCTGGTGATCGTTGTGCTTTTTTTTCTGTGTTGGTTGCCAGTTTATAGTGCCAACACGTGGCGCGCCTTTGATGGCCCGGGTGCACACCGAGCACTCTCGGGTGCTCCTATCTCCTTCATTCACTTGCTGAGCTACGCCTCGGCCTGTGTCAACCCCCTGGTCTACTGCTTCATGCACCGTCGCTTTCGCCAGGCCTGCCTGGAAACTTGCGCTCGCTGCTGCCCCCGGCCTCCACGAGCTCGCCCCAGGGCTCTTCCCGATGAGGACCCTCCCACTCCCTCCATTGCTTCGCTGTCCAGGCTTAGCTACACCACCATCAGCACACTGGGCCCTGGCTGA |
| ORF Protein Sequence | MELLKLNRSVQGTGPGPGASLCRPGAPLLNSSSVGNLSCEPPRIRGAGTRELELAIRITLYAVIFLMSVGGNMLIIVVLGLSRRLRTVTNAFLLSLAVSDLLLAVACMPFTLLPNLMGTFIFGTVICKAVSYLMGVSVSVSTLSLVAIALERYSAICRPLQARVWQTRSHAARVIVATWLLSGLLMVPYPVYTVVQPVGPRVLQCVHRWPSARVRQTWSVLLLLLLFFIPGVVMAVAYGLISRELYLGLRFDGDSDSDSQSRVRNQGGLPGAVHQNGRCRPETGAVGEDSDGCYVQLPRSRPALELTALTAPGPGSGSRPTQAKLLAKKRVVRMLLVIVVLFFLCWLPVYSANTWRAFDGPGAHRALSGAPISFIHLLSYASACVNPLVYCFMHRRFRQACLETCARCCPRPPRARPRALPDEDPPTPSIASLSRLSYTTISTLGPG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T05849-Ab | Anti-GASR/ CCKBR/ CCK-B monoclonal antibody |
| Target Antigen | GM-Tg-g-T05849-Ag | CCKBR VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004002 | Human CCKBR Lentivirus plasmid |
| ORF Viral Vector | pGMLV002240 | Human CCKBR Lentivirus plasmid |
| ORF Viral Vector | pGMAP000136 | Human CCKBR Adenovirus plasmid |
| ORF Viral Vector | vGMLP004002 | Human CCKBR Lentivirus particle |
| ORF Viral Vector | vGMLV002240 | Human CCKBR Lentivirus particle |
| ORF Viral Vector | vGMAP000136 | Human CCKBR Adenovirus particle |
Target information
| Target ID | GM-T05849 |
| Target Name | CCKBR |
| Gene ID | 887, 12426, 712939, 25706, 101098743, 485333, 281665, 100055073 |
| Gene Symbol and Synonyms | CCK-B,CCK-BR,CCK2-R,CCK2R,CCKBR,CCKR-2,Cholrec,GASR |
| Uniprot Accession | P32239 |
| Uniprot Entry Name | GASR_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000110148 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. [provided by RefSeq, Dec 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


