Human CCKBR/CCK-B/CCK2R ORF/cDNA clone-Lentivirus particle (NM_176875.4)

Cat. No.: vGMLV002240

Pre-made Human CCKBR/CCK-B/CCK2R Lentiviral expression plasmid for CCKBR lentivirus packaging, CCKBR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCKBR/CCK-B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002240 Human CCKBR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002240
Gene Name CCKBR
Accession Number NM_176875.4
Gene ID 887
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1344 bp
Gene Alias CCK-B,CCK2R,GASR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGCTGCTAAAGCTGAACCGGAGCGTGCAGGGAACCGGACCCGGGCCGGGGGCTTCCCTGTGCCGCCCGGGGGCGCCTCTCCTCAACAGCAGCAGTGTGGGCAACCTCAGCTGCGAGCCCCCTCGCATTCGCGGAGCCGGGACACGAGAATTGGAGCTGGCCATTAGAATCACTCTTTACGCAGTGATCTTCCTGATGAGCGTTGGAGGAAATATGCTCATCATCGTGGTCCTGGGACTGAGCCGCCGCCTGAGGACTGTCACCAATGCCTTCCTCCTCTCACTGGCAGTCAGCGACCTCCTGCTGGCTGTGGCTTGCATGCCCTTCACCCTCCTGCCCAATCTCATGGGCACATTCATCTTTGGCACCGTCATCTGCAAGGCGGTTTCCTACCTCATGGGGGTGTCTGTGAGTGTGTCCACGCTAAGCCTCGTGGCCATCGCACTGGAGCGGTACAGCGCCATCTGCCGACCACTGCAGGCACGAGTGTGGCAGACGCGCTCCCACGCGGCTCGCGTGATTGTAGCCACGTGGCTGCTGTCCGGACTACTCATGGTGCCCTACCCCGTGTACACTGTCGTGCAACCAGTGGGGCCTCGTGTGCTGCAGTGCGTGCATCGCTGGCCCAGTGCGCGGGTCCGCCAGACCTGGTCCGTACTGCTGCTTCTGCTCTTGTTCTTCATCCCGGGTGTGGTTATGGCCGTGGCCTACGGGCTTATCTCTCGCGAGCTCTACTTAGGGCTTCGCTTTGACGGCGACAGTGACAGCGACAGCCAAAGCAGGGTCCGAAACCAAGGCGGGCTGCCAGGGGCTGTTCACCAGAACGGGCGTTGCCGGCCTGAGACTGGCGCGGTTGGCGAAGACAGCGATGGCTGCTACGTGCAACTTCCACGTTCCCGGCCTGCCCTGGAGCTGACGGCGCTGACGGCTCCTGGGCCGGGATCCGGCTCCCGGCCCACCCAGGCCAAGCTGCTGGCTAAGAAGCGCGTGGTGCGAATGTTGCTGGTGATCGTTGTGCTTTTTTTTCTGTGTTGGTTGCCAGTTTATAGTGCCAACACGTGGCGCGCCTTTGATGGCCCGGGTGCACACCGAGCACTCTCGGGTGCTCCTATCTCCTTCATTCACTTGCTGAGCTACGCCTCGGCCTGTGTCAACCCCCTGGTCTACTGCTTCATGCACCGTCGCTTTCGCCAGGCCTGCCTGGAAACTTGCGCTCGCTGCTGCCCCCGGCCTCCACGAGCTCGCCCCAGGGCTCTTCCCGATGAGGACCCTCCCACTCCCTCCATTGCTTCGCTGTCCAGGCTTAGCTACACCACCATCAGCACACTGGGCCCTGGCTGA
ORF Protein Sequence MELLKLNRSVQGTGPGPGASLCRPGAPLLNSSSVGNLSCEPPRIRGAGTRELELAIRITLYAVIFLMSVGGNMLIIVVLGLSRRLRTVTNAFLLSLAVSDLLLAVACMPFTLLPNLMGTFIFGTVICKAVSYLMGVSVSVSTLSLVAIALERYSAICRPLQARVWQTRSHAARVIVATWLLSGLLMVPYPVYTVVQPVGPRVLQCVHRWPSARVRQTWSVLLLLLLFFIPGVVMAVAYGLISRELYLGLRFDGDSDSDSQSRVRNQGGLPGAVHQNGRCRPETGAVGEDSDGCYVQLPRSRPALELTALTAPGPGSGSRPTQAKLLAKKRVVRMLLVIVVLFFLCWLPVYSANTWRAFDGPGAHRALSGAPISFIHLLSYASACVNPLVYCFMHRRFRQACLETCARCCPRPPRARPRALPDEDPPTPSIASLSRLSYTTISTLGPG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T05849-Ab Anti-GASR/ CCKBR/ CCK-B monoclonal antibody
    Target Antigen GM-Tg-g-T05849-Ag CCKBR VLP (virus-like particle)
    ORF Viral Vector pGMLP004002 Human CCKBR Lentivirus plasmid
    ORF Viral Vector pGMLV002240 Human CCKBR Lentivirus plasmid
    ORF Viral Vector pGMAP000136 Human CCKBR Adenovirus plasmid
    ORF Viral Vector vGMLP004002 Human CCKBR Lentivirus particle
    ORF Viral Vector vGMLV002240 Human CCKBR Lentivirus particle
    ORF Viral Vector vGMAP000136 Human CCKBR Adenovirus particle


    Target information

    Target ID GM-T05849
    Target Name CCKBR
    Gene ID 887, 12426, 712939, 25706, 101098743, 485333, 281665, 100055073
    Gene Symbol and Synonyms CCK-B,CCK-BR,CCK2-R,CCK2R,CCKBR,CCKR-2,Cholrec,GASR
    Uniprot Accession P32239
    Uniprot Entry Name GASR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000110148
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.