Human CCKBR/CCK-B/ GASR ORF/cDNA clone-Adenovirus particle (BC000740)
Pre-made Human CCKBR/CCK-B/ GASR Adenovirus for CCKBR overexpression in-vitro and in-vivo. The CCKBR adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CCKBR-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CCKBR/CCK-B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000136 | Human CCKBR Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000136 |
Gene Name | CCKBR |
Accession Number | BC000740 |
Gene ID | 887 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1344 bp |
Gene Alias | CCK-B, GASR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCTGCTAAAGCTGAACCGGAGCGTGCAGGGAACCGGACCCGGGCCGGGGGCTTCCCTGTGCCGCCCGGGGGCGCCTCTCCTCAACAGCAGCAGTGTGGGCAACCTCAGCTGCGAGCCCCCTCGCATTCGCGGAGCCGGGACACGAGAATTGGAGCTGGCCATTAGAATCACTCTTTACGCAGTGATCTTCCTGATGAGCGTTGGAGGAAATATGCTCATCATCGTGGTCCTGGGACTGAGCCGCCGCCTGAGGACTGTCACCAATGCCTTCCTCCTCTCACTGGCAGTCAGCGACCTCCTGCTGGCTGTGGCTTGCATGCCCTTCACCCTCCTGCCCAATCTCATGGGCACATTCATCTTTGGCACCGTCATCTGCAAGGCGGTTTCCTACCTCATGGGGGTGTCTGTGAGTGTGTCTACGCTAAGCCTCGTGGCCATCGCACTGGAGCGGTACAGCGCCATCTGCCGACCACTGCAGGCACGAGTGTGGCAGACGCGCTCCCACGCGGCTCGCGTGATTGTAGCCACGTGGCTGCTGTCCGGACTACTCATGGTGCCCTACCCCGTGTACACTGTCGTGCAACCAGTGGGGCCTCGTGTGCTGCAGTGCGTGCATCGCTGGCCCAGTGCGCGGGTCCGCCAGACCTGGTCCGTACTGCTGCTTCTGCTCTTGTTCTTCATCCCGGGTGTGGTTATGGCCGTGGCCTACGGGCTTATCTCTCGCGAGCTCTACTTAGGGCTTCGCTTTGACGGCGACAGTGACAGCGACAGCCAAAGCAGGGTCCGAAACCAAGGCGGGCTGCCAGGGGCTGTTCACCAGAACGGGCGTTGCCGGCCTGAGACTGGCGCGGTTGGCGAAGACAGCGATGGCTGCTACGTGCAACTTCCACGTTCCCGGCCTGCCCTGGAGCTGACGGCGCTGACGGCTCCTGGGCCGGGATCCGGCTCCCGGCCCACCCAGGCCAAGCTGCTGGCTAAGAAGCGCGTGGTGCGAATGTTGCTGGTGATCGTTGTGCTTTTTTTTCTGTGTTGGTTGCCAGTTTATAGTGCCAACACGTGGCGCGCCTTTGATGGCCCGGGTGCACACCGAGCACTCTCGGGTGCTCCTATCTCCTTCATTCACTTGCTGAGCTACGCCTCGGCCTGTGTCAACCCCCTGGTCTACTGCTTCATGCACCGTCGCTTTCGCCAGGCCTGCCTGGAAACTTGCGCTCGCTGCTGCCCCCGGCCTCCACGAGCTCGCCCCAGGGCTCTTCCCGATGAGGACCCTCCCACTCCCTCCATTGCTTCGCTGTCCAGGCTTAGCTACACCACCATCAGCACACTGGGCCCTGGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T05849-Ab | Anti-GASR/ CCKBR/ CCK-B monoclonal antibody |
Target Antigen | GM-Tg-g-T05849-Ag | CCKBR VLP (virus-like particle) |
ORF Viral Vector | pGMLP004002 | Human CCKBR Lentivirus plasmid |
ORF Viral Vector | pGMAP000136 | Human CCKBR Adenovirus plasmid |
ORF Viral Vector | vGMLP004002 | Human CCKBR Lentivirus particle |
ORF Viral Vector | vGMAP000136 | Human CCKBR Adenovirus particle |
ORF Viral Vector | pGMLV002240 | Human CCKBR Lentivirus plasmid |
Target information
Target ID | GM-T05849 |
Target Name | CCKBR |
Gene ID | 887, 12426, 712939, 25706, 101098743, 485333, 281665, 100055073 |
Gene Symbol and Synonyms | CCK-B,CCK-BR,CCK2-R,CCK2R,CCKBR,CCKR-2,Cholrec,GASR |
Uniprot Accession | P32239 |
Uniprot Entry Name | GASR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000110148 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. [provided by RefSeq, Dec 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.