- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CCKBR/CCK-B/ GASR ORF/cDNA clone-Lentivirus particle (BC000740)
Pre-made Human CCKBR/CCK-B/ GASR Lentiviral expression plasmid for CCKBR lentivirus packaging, CCKBR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CCKBR/CCK-B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004002 | Human CCKBR Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004002 |
| Gene Name | CCKBR |
| Accession Number | BC000740 |
| Gene ID | 887 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1344 bp |
| Gene Alias | CCK-B, GASR |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGAGCTGCTAAAGCTGAACCGGAGCGTGCAGGGAACCGGACCCGGGCCGGGGGCTTCCCTGTGCCGCCCGGGGGCGCCTCTCCTCAACAGCAGCAGTGTGGGCAACCTCAGCTGCGAGCCCCCTCGCATTCGCGGAGCCGGGACACGAGAATTGGAGCTGGCCATTAGAATCACTCTTTACGCAGTGATCTTCCTGATGAGCGTTGGAGGAAATATGCTCATCATCGTGGTCCTGGGACTGAGCCGCCGCCTGAGGACTGTCACCAATGCCTTCCTCCTCTCACTGGCAGTCAGCGACCTCCTGCTGGCTGTGGCTTGCATGCCCTTCACCCTCCTGCCCAATCTCATGGGCACATTCATCTTTGGCACCGTCATCTGCAAGGCGGTTTCCTACCTCATGGGGGTGTCTGTGAGTGTGTCTACGCTAAGCCTCGTGGCCATCGCACTGGAGCGGTACAGCGCCATCTGCCGACCACTGCAGGCACGAGTGTGGCAGACGCGCTCCCACGCGGCTCGCGTGATTGTAGCCACGTGGCTGCTGTCCGGACTACTCATGGTGCCCTACCCCGTGTACACTGTCGTGCAACCAGTGGGGCCTCGTGTGCTGCAGTGCGTGCATCGCTGGCCCAGTGCGCGGGTCCGCCAGACCTGGTCCGTACTGCTGCTTCTGCTCTTGTTCTTCATCCCGGGTGTGGTTATGGCCGTGGCCTACGGGCTTATCTCTCGCGAGCTCTACTTAGGGCTTCGCTTTGACGGCGACAGTGACAGCGACAGCCAAAGCAGGGTCCGAAACCAAGGCGGGCTGCCAGGGGCTGTTCACCAGAACGGGCGTTGCCGGCCTGAGACTGGCGCGGTTGGCGAAGACAGCGATGGCTGCTACGTGCAACTTCCACGTTCCCGGCCTGCCCTGGAGCTGACGGCGCTGACGGCTCCTGGGCCGGGATCCGGCTCCCGGCCCACCCAGGCCAAGCTGCTGGCTAAGAAGCGCGTGGTGCGAATGTTGCTGGTGATCGTTGTGCTTTTTTTTCTGTGTTGGTTGCCAGTTTATAGTGCCAACACGTGGCGCGCCTTTGATGGCCCGGGTGCACACCGAGCACTCTCGGGTGCTCCTATCTCCTTCATTCACTTGCTGAGCTACGCCTCGGCCTGTGTCAACCCCCTGGTCTACTGCTTCATGCACCGTCGCTTTCGCCAGGCCTGCCTGGAAACTTGCGCTCGCTGCTGCCCCCGGCCTCCACGAGCTCGCCCCAGGGCTCTTCCCGATGAGGACCCTCCCACTCCCTCCATTGCTTCGCTGTCCAGGCTTAGCTACACCACCATCAGCACACTGGGCCCTGGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T05849-Ab | Anti-GASR/ CCKBR/ CCK-B monoclonal antibody |
| Target Antigen | GM-Tg-g-T05849-Ag | CCKBR VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004002 | Human CCKBR Lentivirus plasmid |
| ORF Viral Vector | pGMAP000136 | Human CCKBR Adenovirus plasmid |
| ORF Viral Vector | vGMLP004002 | Human CCKBR Lentivirus particle |
| ORF Viral Vector | vGMAP000136 | Human CCKBR Adenovirus particle |
| ORF Viral Vector | pGMLV002240 | Human CCKBR Lentivirus plasmid |
Target information
| Target ID | GM-T05849 |
| Target Name | CCKBR |
| Gene ID | 887, 12426, 712939, 25706, 101098743, 485333, 281665, 100055073 |
| Gene Symbol and Synonyms | CCK-B,CCK-BR,CCK2-R,CCK2R,CCKBR,CCKR-2,Cholrec,GASR |
| Uniprot Accession | P32239 |
| Uniprot Entry Name | GASR_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000110148 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. [provided by RefSeq, Dec 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
